Sequence ID | >W1930012062 |
Genome ID | MASH01000024 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Bemisia tabaci of Bemisia tabaci Asia II 3 [MASH] |
Start position on genome | 3180 |
End posion on genome | 3104 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
cgctatcgga |
tRNA gene sequence |
CGCGGGATGGAGCAGCTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCATCGGTTCAAA |
Downstream region at tRNA end position |
cctttcattc |
Secondary structure (Cloverleaf model) | >W1930012062 fMet CAT a ACCA cctttcattc C A G - C C - G G - C G - C G - C A C T A T C G G C C A C G A G + | | | A T C G A G A T C G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |