Sequence ID | >W1930035167 |
Genome ID | OUND01000003 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 64546 |
End posion on genome | 64621 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttataaatat |
tRNA gene sequence |
GCGAGAATAGCTCAGTTAGTAGAGCACGACCTTGCCAAGGTCGGGATCGCGAGTTCGAGT |
Downstream region at tRNA end position |
aattctcctt |
Secondary structure (Cloverleaf model) | >W1930035167 Gly GCC t TCCA aattctcctt G - C C - G G - C A C G - C A - T A - T T G T T G T T C A T G A A + | + | | G T C T C G G C G A G C A | | | | T T G G A G C T A A GGATC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |