The detailed information of tRNA gene sequence


Sequence ID>W1930018411
Genome IDMNVY01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 33506
End posion on genome 33430
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
aattggaaaT
tRNA gene sequence
GACTCCGTAGTTCAGTTTGGTCAGAGCACTGGATTCTTAATCCAGATGTCATGGGTTCAA
ATCCCACCGGGGCCATtt
Downstream region at tRNA end position
gggatttgaa
Secondary structure (Cloverleaf model)
>W1930018411	Lys	CTT
                   T      ATtt gggatttgaa
                     G - C
                     A   C
                     C - G
                     T + G
                     C - G
                     C - G
                     G - C          T A
                    T     C A C C C     A
    T T G A        A        | | | |     A
  T         C T T G       A T G G G     C
  G         | | + |                 T T
  G         G A G C
    T C A          A     ATGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK