The detailed information of tRNA gene sequence


Sequence ID>W1930014978
Genome IDMFWM01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 47447
End posion on genome 47374
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
gtcttattaG
tRNA gene sequence
GCCTGTGTAGCTCAGTGGCAGAGCACCTGCCCTGTAAGCAGGGGGTCGGGGGTTCAAATC
CCTCCACAGGCTTta
Downstream region at tRNA end position
ttcatgttca
Secondary structure (Cloverleaf model)
>W1930014978	Thr	TGT
                   G      TTta ttcatgttca
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C
                     T - A
                     G - C          T A
                    T     C T C C C     A
        G A        A      | + | | |     A
      T     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        C A        A     GGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       A
                  C       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK