The detailed information of tRNA gene sequence


Sequence ID>W1930014983
Genome IDMFWN01000037
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 10730
End posion on genome 10800
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tcataaatac
tRNA gene sequence
GGGCGTATCGTTCATCGGTAGGACGCTTCGTTTACACCGAAGGGAGAGAGGTCCGACTCC
TCTTACGCCCAtat
Downstream region at tRNA end position
tttttgaaaa
Secondary structure (Cloverleaf model)
>W1930014983	Val	TAC
                   c      Atat tttttgaaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     T - A
                     A - T          T C
                    T     T C T C C     A
        T A        C      | | | | |     G
      C     C T T G       A G A G G     C
      G     | + | |                 T C
      G     G G A C
        T A        G     GGAG
                    C - G
                    T - A
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK