The detailed information of tRNA gene sequence


Sequence ID>W1930014993
Genome IDMFWP01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 24395
End posion on genome 24319
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tgaaatataT
tRNA gene sequence
AGCAGCGTAGAGCAGCCTGGAGTGCTCGCCGGGCCCATAACCCGGAGGTCAATGGTTCAA
ATCCATTCGCTGCTATtt
Downstream region at tRNA end position
tcttattctc
Secondary structure (Cloverleaf model)
>W1930014993	Met	CAT
                   T      ATtt tcttattctc
                     A - T
                     G - C
                     C - G
                     A - T
                     G - C
                     C - G
                     G - C          T A
                    T     T T A C C     A
    C C G A        A      | | | | |     A
  T         C G A G       A A T G G     C
  G         | | | |                 T T
  G         G C T C
    A G T          G     AGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  C       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK