The detailed information of tRNA gene sequence


Sequence ID>W1910155437
Genome IDBIMP01000001
Search identical group
Phylum/ClassCyanobacteria
Speciescyanobiont of Ornithocercus magnificus OmCyn01 (BIMP)
Start position on genome 1542239
End posion on genome 1542158
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
cgtcagccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAtta
Downstream region at tRNA end position
acttttaact
Secondary structure (Cloverleaf model)
>W1910155437	Leu	GAG
                   c      Atta acttttaact
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK