The detailed information of tRNA gene sequence


Sequence ID>W1910183024
Genome IDBJNJ01000037
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSinorhizobium meliloti NBRC 14782 (BJNJ)
Start position on genome 69701
End posion on genome 69796
Amino Acid Sec
Anticodon TCA
Upstream region at tRNA start position
ttcgacgcct
tRNA gene sequence
GGAAGAGAATCATGCCCGGTGGCATGTCCGGACTTCAAATCCGGGTGGGGCAGCGAGGCT
GTCTTGGGTGGGTTCGACTCCCATTCTCTTCCGCCA
Downstream region at tRNA end position
tcaggagacc
Secondary structure (Cloverleaf model)
>W1910183024	Sec	TCA
                   t      GCCA tcaggagacc
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T C
                    A     T A C C C     A
      C C C        T      + | | | |     G
    G       G T A C       G T G G G     C
    G       | | | |                 T T
    T       C A T G
      G G          T     GTGGGGCAGCGAGGCTGTCTTGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK