The detailed information of tRNA gene sequence


Sequence ID>W1910183764
Genome IDBJNZ01000025
Search identical group
Phylum/ClassActinobacteria
SpeciesCellulosimicrobium cellulans NBRC 15516 (BJNZ)
Start position on genome 56592
End posion on genome 56521
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ccagcgccgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCag
Downstream region at tRNA end position
cgctcgagag
Secondary structure (Cloverleaf model)
>W1910183764	Gly	CCC
                   c      TCag cgctcgagag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK