The detailed information of tRNA gene sequence


Sequence ID>W1910209044
Genome IDFLYE01000021
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesTerasakiella sp. PR1 (FLYE)
Start position on genome 2044
End posion on genome 2120
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
aaggcttttt
tRNA gene sequence
GGGCCTATAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTAGTTCAAA
TCTACCTAGGCCCACCA
Downstream region at tRNA end position
tgaatttggg
Secondary structure (Cloverleaf model)
>W1910209044	Ile	GAT
                   t      ACCA tgaatttggg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     A - T          T A
                    T     C C A T C     A
      T G A        A      | | | | |     A
    T       C T C G       G G T A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK