The detailed information of tRNA gene sequence


Sequence ID>W1910229843
Genome IDFOHQ01000002
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides vulcani SLH 33 (FOHQ)
Start position on genome 282989
End posion on genome 283063
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
cacatgcgtt
tRNA gene sequence
GGGCCGGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATCGGCCGAGGGTTCAAA
TCCCTTCCGGCCCGCtt
Downstream region at tRNA end position
tcaattcatg
Secondary structure (Cloverleaf model)
>W1910229843	Lys	CTT
                   t      GCtt tcaattcatg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     A
    C       T T C G       G A G G G     C
    A       + | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK