The detailed information of tRNA gene sequence


Sequence ID>C09101569
Genome IDCP001618
Search identical group
Phylum/ClassActinobacteria
SpeciesBeutenbergia cavernae DSM 12333
Start position on genome 4248916
End posion on genome 4248989
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gcggcgtcac
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCC
Downstream region at tRNA end position
ttcgaaggcg
Secondary structure (Cloverleaf model)
>C09101569	Gly	CCC
                   c      TCCC ttcgaaggcg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK