The detailed information of tRNA gene sequence


Sequence ID>W1910498912
Genome IDFXXM01000010
Search identical group
Phylum/ClassFirmicutes
SpeciesPaucisalibacillus globulus PG (FXXM)
Start position on genome 135701
End posion on genome 135629
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
ttattcatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAttg
Downstream region at tRNA end position
atacagatag
Secondary structure (Cloverleaf model)
>W1910498912	Ala	GGC
                   c      Attg atacagatag
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK