The detailed information of tRNA gene sequence


Sequence ID>W1910548609
Genome IDFZOQ01000006
Search identical group
Phylum/ClassBacteroidetes
SpeciesPontibacter ummariensis NKM1 (FZOQ)
Start position on genome 127617
End posion on genome 127544
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
atgcggagat
tRNA gene sequence
TGTCCGATGGTGTAACTGGCAACACGTCTGATTTTGGTTCAGAAGAGTCCAGGTTCGAGC
CCTGGTCGGACAACat
Downstream region at tRNA end position
aaaaaagaac
Secondary structure (Cloverleaf model)
>W1910548609	Gln	TTG
                   t      ACat aaaaaagaac
                     T - A
                     G - C
                     T - A
                     C - G
                     C - G
                     G - C
                     A - T          C G
                    T     G G T C C     A
      C A A        G      | | | | |     G
    T       T G T G       C C A G G     C
    G       | | | |                 T T
    G       A C A C
      C A          G     AGAGT
                    T - A
                    C - G
                    T - A
                    G - C
                    A - T
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK