The detailed information of tRNA gene sequence


Sequence ID>W1910575261
Genome IDJRHO01000009
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides methylutens DSM 2657 (JRHO)
Start position on genome 363634
End posion on genome 363708
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
catatgcgtt
tRNA gene sequence
GGGCCGGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATCGGCCGAGGGTTCAAA
TCCCTTCCGGCCCGCtt
Downstream region at tRNA end position
ttatgagatc
Secondary structure (Cloverleaf model)
>W1910575261	Lys	CTT
                   t      GCtt ttatgagatc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     A
    C       T T C G       G A G G G     C
    A       + | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK