The detailed information of tRNA gene sequence


Sequence ID>W1910576043
Genome IDJRZZ01000002
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesErwinia sp. B116 (JRZZ)
Start position on genome 171973
End posion on genome 171901
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcccgccgct
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACtt
Downstream region at tRNA end position
tcctacagtt
Secondary structure (Cloverleaf model)
>W1910576043	Arg	CCT
                   t      ACtt tcctacagtt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK