The detailed information of tRNA gene sequence


Sequence ID>W1910651915
Genome IDLYMU01000129
Search identical group
Phylum/ClassBacteroidetes
SpeciesHymenobacter sp. UV11 (LYMU)
Start position on genome 223360
End posion on genome 223432
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tttggggctt
tRNA gene sequence
GGCTGCGTAGTTCAAGGGATAGAATAGGCGTTTCCTAAACGCTTGATAGCAGTTCGAATC
TGCTCGTGGCTACat
Downstream region at tRNA end position
atataatttt
Secondary structure (Cloverleaf model)
>W1910651915	Arg	CCT
                   t      ACat atataatttt
                     G + T
                     G - C
                     C - G
                     T + G
                     G + T
                     C - G
                     G - C          T A
                    T     T C G T C     A
      G A A        A      | | | | |     G
    G       C T T G       A G C A G     C
    G       | | | +                 T T
    A       G A A T
      T A          A     TGAT
                    G + T
                    G - C
                    C - G
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK