Sequence ID | >W1910657533 |
Genome ID | MASH01000292 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Bemisia tabaci of Bemisia tabaci Asia II 3 [MASH] |
Start position on genome | 825 |
End posion on genome | 741 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caccgtattt |
tRNA gene sequence |
GCGGGAGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGCG |
Downstream region at tRNA end position |
ttgtttataa |
Secondary structure (Cloverleaf model) | >W1910657533 Leu TAG t ACCA ttgtttataa G - C C - G G - C G - C G - C A - T G - C T G T C G C T C A T A A G | | | | | A T A G C G G C G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |