The detailed information of tRNA gene sequence


Sequence ID>W1910702389
Genome IDMEYH01000053
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesCandidatus Atribacteria bacterium RBG_19FT_COMBO_35_14 (MEYH)
Start position on genome 18660
End posion on genome 18736
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
caaaatacgg
tRNA gene sequence
CGCGGGGTGGAGCAGTCAGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGGTGGTTCGAA
TCCGCCCCCCGCAACCA
Downstream region at tRNA end position
acttccaaaa
Secondary structure (Cloverleaf model)
>W1910702389	Met	CAT
                   g      ACCA acttccaaaa
                     C   A
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | + | |     G
    C       C G A G       G G T G G     C
    A       | | | |                 T T
    G       G C T C
      G T A        G     AGGTC
                    T - A
                    C - G
                    A - T
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK