The detailed information of tRNA gene sequence


Sequence ID>W1910702398
Genome IDMEYH01000059
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesCandidatus Atribacteria bacterium RBG_19FT_COMBO_35_14 (MEYH)
Start position on genome 6600
End posion on genome 6526
Amino Acid Glu
Anticodon CTC
Upstream region at tRNA start position
agtgattatt
tRNA gene sequence
GGCGCAATCGAATAGTGGTTAATTCGGCTGGCTCTCAATCAGCAAACGGGGGTTCAATTC
CCCCTTGCGCTACCA
Downstream region at tRNA end position
atatttttaa
Secondary structure (Cloverleaf model)
>W1910702398	Glu	CTC
                   t      ACCA atatttttaa
                     G + T
                     G - C
                     C - G
                     G - C
                     C - G
                     A - T
                     A - T          T T
                    T     C C C C C     A
      T G A        C      | | | | |     A
    G       T A A G       G G G G G     C
    G       | | | |                 T T
    T       A T T C
      T A          G     AAAC
                    G - C
                    C - G
                    T - A
                    G - C
                    G + T
                  C       A
                  T       A
                    C T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK