The detailed information of tRNA gene sequence


Sequence ID>W1910716587
Genome IDMFWM01000002
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 82495
End posion on genome 82423
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
gcttggttaa
tRNA gene sequence
GTCCCGGTAGCTCAGCTGGTAGAGCACATGACTGTTAATCATGGGGTCGTAGGTTCGAGT
CCTGCCCGGGACGttt
Downstream region at tRNA end position
actttttctt
Secondary structure (Cloverleaf model)
>W1910716587	Asn	GTT
                   a      Gttt actttttctt
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T G
                    T     C G T C C     A
      C G A        A      | + | | |     G
    T       C T C G       G T A G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GGGTC
                    C - G
                    A - T
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK