The detailed information of tRNA gene sequence


Sequence ID>W1910716590
Genome IDMFWM01000003
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 3937
End posion on genome 3866
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
gttcgtaatg
tRNA gene sequence
GTGAGTGTAGTTTAGTGGCAGAACGCGCGACTGTGGCTCGTGTAACGGGAGTTCGATTCT
CCCCATTCACCCtc
Downstream region at tRNA end position
ataaataagg
Secondary structure (Cloverleaf model)
>W1910716590	His	GTG
                   g      CCtc ataaataagg
                     G - C
                     T - A
                     G - C
                     A - T
                     G + T
                     T - A
                     G - C          T T
                    T     C C C T C     A
        G A        A      | | | | |     G
      T     T T T G       G G G A G     C
      G     + | | |                 T T
      G     G A A C
        C A        G     TAAC
                    C - G
                    G + T
                    C - G
                    G - C
                    A - T
                  C       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK