The detailed information of tRNA gene sequence


Sequence ID>W1910716593
Genome IDMFWM01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 38350
End posion on genome 38422
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aaatcaataa
tRNA gene sequence
AGCCCCATGGTCTAGTGGTCAAAGATTCAGCCCTTTGGAGGCTGAGACCCCGGTTCGAAT
CCGGGTGGGGCTAttt
Downstream region at tRNA end position
ctctttatat
Secondary structure (Cloverleaf model)
>W1910716593	Gln	TTG
                   a      Attt ctctttatat
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T A
                    T     G G G C C     A
      T G A        G      | | | | |     G
    G       T C T G       C C C G G     C
    G       | | | +                 T T
    T       A G A T
      C A A        T     AGAC
                    C - G
                    A - T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK