The detailed information of tRNA gene sequence


Sequence ID>W1910716595
Genome IDMFWM01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 61532
End posion on genome 61604
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
aggaaatatc
tRNA gene sequence
GCGGAGGTGGCACAGCGGCTACTGCAATCGGTTGCAGCCCGGTTATTCGTGGGTTCGAGT
CCCACCCTCCGCTttc
Downstream region at tRNA end position
tatttcacag
Secondary structure (Cloverleaf model)
>W1910716595	Cys	GCA
                   c      Tttc tatttcacag
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C          T G
                    T     C A C C C     A
      C G A        G      | | | | |     G
    G       C A C G       G T G G G     C
    G         | | |                 T T
    C       C T G C
      T A          A     TATTC
                    A - T
                    T + G
                    C - G
                    G - C
                    G - C
                  T       C
                  T       G
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK