The detailed information of tRNA gene sequence


Sequence ID>W1910716597
Genome IDMFWM01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 48460
End posion on genome 48389
Amino Acid Val
Anticodon GAC
Upstream region at tRNA start position
atttatttta
tRNA gene sequence
GGTCCCATAGTCCAATGGCTAAGACACATCCTTGACGTGGATGAAACCCAGGTTCAATTC
CTGGTGGGACCAttg
Downstream region at tRNA end position
ctaaatttta
Secondary structure (Cloverleaf model)
>W1910716597	Val	GAC
                   a      Attg ctaaatttta
                     G - C
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     A - T          T T
                    T     G G T C C     A
      T A A        A      | | | | |     A
    G       C C T G       C C A G G     C
    G         | | |                 T T
    C       A G A C
      T A          A     AAAC
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  T       T
                  T       G
                    G A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK