The detailed information of tRNA gene sequence


Sequence ID>W1910716600
Genome IDMFWM01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 5571
End posion on genome 5644
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tttaataatT
tRNA gene sequence
GGGGTCCTAGCTCAGCGGGAGAGCACTACGCTGAAGACGTAGGTGTCCCGGGTTCGACTC
CCGGGGACCCCATtt
Downstream region at tRNA end position
ataattttaa
Secondary structure (Cloverleaf model)
>W1910716600	Phe	GAA
                   T      ATtt ataattttaa
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     C - G          T C
                    T     G G C C C     A
        G A        A      | | | | |     G
      C     C T C G       C C G G G     C
      G     | | | |                 T T
      G     G A G C
        G A        A     GTGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    G - C
                  C       A
                  T       G
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK