The detailed information of tRNA gene sequence


Sequence ID>W1910716601
Genome IDMFWM01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 147167
End posion on genome 147250
Amino Acid Leu
Anticodon AAG
Upstream region at tRNA start position
gtaatatcaa
tRNA gene sequence
GCGGGAATGCCAGAGCGGTCAAATGGGCGAGATTAAGGCTCTCGTGGCTTAGTGCCTGCG
AAGGTTCAAATCCTTCTTCCCGCAtat
Downstream region at tRNA end position
ttggataagg
Secondary structure (Cloverleaf model)
>W1910716601	Leu	AAG
                   a      Atat ttggataagg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T          T A
                    T     C T T C C     A
      C G A        G      | | | | |     A
    G       G A C C       G A A G G     C
    G         | | |                 T T
    T       A T G G
      C A A        G     TGGCTTAGTGCCTGC
                    C - G
                    G - C
                    A - T
                    G - C
                    A - T
                  T       C
                  T       G
                    A A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK