The detailed information of tRNA gene sequence


Sequence ID>W1910716602
Genome IDMFWM01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 146652
End posion on genome 146575
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
taaaaagtaT
tRNA gene sequence
GCGCCTGTAGCTCAGTCTGGATTAGAGCATCTCCGTCCTAAGGAGGGGGTCACAGGTTCA
AATCCTGTCAGGCGCGTtt
Downstream region at tRNA end position
tgagattgta
Secondary structure (Cloverleaf model)
>W1910716602	Arg	CCT
                   T      GTtt tgagattgta
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     T G T C C     A
    C T G A        A      | | | | |     A
  T         C T C G       A C A G G     C
  G         | | | |                 T T
  G         G A G C
    A T T A        A     GGGTC
                    T + G
                    C - G
                    T - A
                    C - G
                    C - G
                  G       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK