The detailed information of tRNA gene sequence


Sequence ID>W1910716604
Genome IDMFWM01000011
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_33_26 (MFWM)
Start position on genome 28761
End posion on genome 28833
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
attacaggac
tRNA gene sequence
GCCCCGTTAGTCTAGAGGCCAAGGACACAACCCTTTCAAGGTTGAAACCCGGGTTCGAAT
CCCGGACGGGGCAtaa
Downstream region at tRNA end position
accaaccgaa
Secondary structure (Cloverleaf model)
>W1910716604	Glu	TTC
                   c      Ataa accaaccgaa
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     G G C C C     A
      A G A        A      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | |                 T T
    C       G G A C
      C A A        A     AAAC
                    C - G
                    A - T
                    A - T
                    C - G
                    C - G
                  C       A
                  T       A
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK