The detailed information of tRNA gene sequence


Sequence ID>W1910716605
Genome IDMFWN01000005
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 10847
End posion on genome 10918
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
accattcaaa
tRNA gene sequence
GCGGCTTTGGTCTAACGGCTATGACACGACCTTCCCAAGGTCGTTGCGCGGGTTCAACTC
CCGCAAGCCGCAttt
Downstream region at tRNA end position
attttctcta
Secondary structure (Cloverleaf model)
>W1910716605	Gly	CCC
                   a      Attt attttctcta
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     T - A
                     T - A          T C
                    T     C G C C C     A
      C A A        G      | | | | |     A
    G       T C T G       G C G G G     C
    G         | | |                 T T
    C       T G A C
      T A          A     TTGC
                    C - G
                    G - C
                    A - T
                    C - G
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK