The detailed information of tRNA gene sequence


Sequence ID>W1910716606
Genome IDMFWN01000005
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 22650
End posion on genome 22575
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
tttattgaat
tRNA gene sequence
GAGGCTGTAGCTCAGCCCGGTTAGAGCACGGCTCTGATAAGGCCGGGGTCCACAGTTCAA
ATCTGTGCAGCCTCACtc
Downstream region at tRNA end position
actttttatt
Secondary structure (Cloverleaf model)
>W1910716606	Ile	GAT
                   t      ACtc actttttatt
                     G - C
                     A - T
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C          T A
                    T     G T G T C     A
    C C G A        A      | | | | |     A
  C         C T C G       C A C A G     C
  G         | | | |                 T T
  G         G A G C
    T T A          A     GGGTC
                    C - G
                    G - C
                    G - C
                    C - G
                    T + G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK