The detailed information of tRNA gene sequence


Sequence ID>W1910716607
Genome IDMFWN01000006
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 17710
End posion on genome 17635
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
aaaaatataT
tRNA gene sequence
GCCCCCGTGGCGTAACTGGACAACGCAGCAGCATCCTAAGCTGAAGATTACAGGTTCAAC
TCCTGTCGGGGGCGTtt
Downstream region at tRNA end position
atccttagga
Secondary structure (Cloverleaf model)
>W1910716607	Arg	CCT
                   T      GTtt atccttagga
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T C
                    T     T G T C C     A
      C A A        G      | | | | |     A
    T       T G C G       A C A G G     C
    G       | | | |                 T T
    G       A C G C
      A C A        A     AGATT
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  A       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK