The detailed information of tRNA gene sequence


Sequence ID>W1910716608
Genome IDMFWN01000025
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 19510
End posion on genome 19594
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
tagataaccT
tRNA gene sequence
GCCGGCATGCCAGAACGGTTAATGGGCGTGTCTCGAAAACACGTGTCCGAAAGGACGCCT
AGGTTCGAATCCTAGTGCCGGCGTtt
Downstream region at tRNA end position
atattttaat
Secondary structure (Cloverleaf model)
>W1910716608	Ser	CGA
                   T      GTtt atattttaat
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     C - G
                     A - T          T A
                    T     G A T C C     A
      C A A        G      | | | | |     G
    G       G A C C       C T A G G     C
    G         | | |                 T T
    T       A T G G
      T A          G     TGTCCGAAAGGACGC
                    C - G
                    G - C
                    T - A
                    G - C
                    T - A
                  C       A
                  T       A
                    C G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK