The detailed information of tRNA gene sequence


Sequence ID>W1910716610
Genome IDMFWN01000051
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 46887
End posion on genome 46957
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
aaatgtatgg
tRNA gene sequence
GGGCTCGTCATTCAACGGCAGGATGCAAGATTCGCATTCTTGACATTCGGGTTCAATTCC
CGACGAGTCCAtaa
Downstream region at tRNA end position
gttaagtgat
Secondary structure (Cloverleaf model)
>W1910716610	Ala	CGC
                   g      Ataa gttaagtgat
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T T
                    T     A G C C C     A
        A A        C      | | | | |     A
      C     C T T A       T C G G G     C
      G     | + | |                 T T
      G     G G A T
        C A        G     ACAT
                    C - G
                    A - T
                    A - T
                    G - C
                    A - T
                  T       T
                  T       A
                    C G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK