The detailed information of tRNA gene sequence


Sequence ID>W1910716611
Genome IDMFWN01000051
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 34573
End posion on genome 34497
Amino Acid Pro
Anticodon TGG
Upstream region at tRNA start position
agcgaacaaT
tRNA gene sequence
GGGGATGTCGGCTAGTCTGGTTTAGGCTTCAAGCCTTGGGAGTTTGCGACCCAGGTTCAA
ATCCTGGCATCCCCATtt
Downstream region at tRNA end position
ttttagagca
Secondary structure (Cloverleaf model)
>W1910716611	Pro	TGG
                   T      ATtt ttttagagca
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T A
                    T     G G T C C     A
    C T G A        C      | | | | |     A
  T         T C G G       C C A G G     C
  G         + | | +                 T T
  G         G G C T
    T T T A        T     CGAC
                    C - G
                    A - T
                    A - T
                    G + T
                    C - G
                  C       A
                  T       G
                    T G G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK