The detailed information of tRNA gene sequence


Sequence ID>W1910716612
Genome IDMFWN01000062
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 3453
End posion on genome 3371
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
gcacaagcaT
tRNA gene sequence
GCCCGGATCGCATAACGGTATTGCACAAGCCTGGAAAGCTTGACCCTTCGGGGTGCCCAG
GTTCGACTCCTGGTCCGGGCGTaa
Downstream region at tRNA end position
agcttatcag
Secondary structure (Cloverleaf model)
>W1910716612	Ser	GGA
                   T      GTaa agcttatcag
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T C
                    T     G G T C C     A
        A A        C      | | | | |     G
      C     T A C G       C C A G G     C
      G       | | |                 T T
      G     T T G C
        T A        A     ACCCTTCGGGGTGC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    G G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK