The detailed information of tRNA gene sequence


Sequence ID>W1910716613
Genome IDMFWN01000075
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 22960
End posion on genome 23034
Amino Acid Gln
Anticodon CTG
Upstream region at tRNA start position
gtgttattaT
tRNA gene sequence
AGCCCCGTAGTCTAGTGGTCAAGGATCCGGCCCTCTGGAGGCTGGGACCCAGGTTCGAAT
CCTGGCGGGGCTATac
Downstream region at tRNA end position
tatattttgt
Secondary structure (Cloverleaf model)
>W1910716613	Gln	CTG
                   T      ATac tatattttgt
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G T C C     A
      T G A        A      | | | | |     G
    G       T C T G       C C A G G     C
    G       + | | +                 T T
    T       G G A T
      C A A        C     GGAC
                    C - G
                    G + T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    C T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK