The detailed information of tRNA gene sequence


Sequence ID>W1910716614
Genome IDMFWN01000080
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 11411
End posion on genome 11337
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ggtaattaaT
tRNA gene sequence
GGCTCAGTAGATCAGCGGTCGGATCGCCGCTCTCATAAGGCGGATGTCGGGAGTTCGACT
CTCCCCTGAGCCATtt
Downstream region at tRNA end position
ttaaaatgac
Secondary structure (Cloverleaf model)
>W1910716614	Met	CAT
                   T      ATtt ttaaaatgac
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     A - T
                     G - C          T C
                    T     C C C T C     A
      C G A        A      | | | | |     G
    G       C T A G       G G G A G     C
    G       | | | |                 T T
    T       G A T C
      C G          G     ATGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T + G
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK