The detailed information of tRNA gene sequence


Sequence ID>W1910716615
Genome IDMFWN01000080
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 4526
End posion on genome 4454
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
agtaactcag
tRNA gene sequence
GGGCCTGTATTATAACGGTTCATTATTTTCGGCTGGCAGTCGAAAGATCCGGGTTCGATT
CCCGGCAGGTCCAtta
Downstream region at tRNA end position
tgtctaaact
Secondary structure (Cloverleaf model)
>W1910716615	Ala	GGC
                   g      Atta tgtctaaact
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T T
                    T     G G C C C     A
      C A A        A      | | | | |     G
    G       T A T T       C C G G G     C
    G         | |                   T T
    T       T T A T
      T C A        T     AGAT
                    T - A
                    T - A
                    C - G
                    G - C
                    G + T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK