The detailed information of tRNA gene sequence


Sequence ID>W1910716616
Genome IDMFWN01000081
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_13_36_9 (MFWN)
Start position on genome 34921
End posion on genome 34996
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
tttcacctaA
tRNA gene sequence
GCCTCTGTAGCTCAACGGCCTAGAGCATCAGTTTTGTAAACTGGGGGTTGGGGGTTCGAT
TCCCTCCAGAGGCTTtt
Downstream region at tRNA end position
tttactttga
Secondary structure (Cloverleaf model)
>W1910716616	Thr	TGT
                   A      TTtt tttactttga
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     T - A
                     G - C          T T
                    T     C T C C C     A
      C A A        A      | + | | |     G
    G       C T C G       G G G G G     C
    G       | | | |                 T T
    C       G A G C
      C T A        A     GGGTT
                    T + G
                    C - G
                    A - T
                    G - C
                    T - A
                  T       A
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK