The detailed information of tRNA gene sequence


Sequence ID>W1910716617
Genome IDMFWO01000004
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 2739
End posion on genome 2812
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
cttttatcgt
tRNA gene sequence
GCCTGTGTAGCTCAGTTGGTAAGAGTACGTCCTTGGTAAGGACGGGGTCCCGAGTTCGAC
TCTCGGCACAGGCTttc
Downstream region at tRNA end position
attaagttta
Secondary structure (Cloverleaf model)
>W1910716617	Thr	GGT
                   t      Tttc attaagttta
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C
                     T - A
                     G - C          T C
                    T     G G C T C     A
      T G A        A      | | | | |     G
    T       C T C G       C C G A G     C
    G       | | | +                 T T
    G       G A G T
      T A A        A     GGGTC
                    C - G
                    G - C
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK