The detailed information of tRNA gene sequence


Sequence ID>W1910716618
Genome IDMFWO01000008
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 15028
End posion on genome 15098
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ggaatgggac
tRNA gene sequence
GGCCTCATAGTCTAGTGGCAAAACAGTTCGTTTACACCGAACGGTCCGCAGTTCGATTCT
GCGTGGGGCCAtaa
Downstream region at tRNA end position
aaactcgagg
Secondary structure (Cloverleaf model)
>W1910716618	Val	TAC
                   c      Ataa aaactcgagg
                     G - C
                     G - C
                     C - G
                     C - G
                     T + G
                     C - G
                     A - T          T T
                    T     G C G T C     A
        G A        A      | | | | |     G
      T     T C T G       C G C A G     C
      G     |   | |                 T T
      G     A A A C
        C A        A     GGTC
                    G - C
                    T - A
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK