The detailed information of tRNA gene sequence


Sequence ID>W1910716619
Genome IDMFWO01000011
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 7208
End posion on genome 7133
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
ttttattaaT
tRNA gene sequence
GAGCCTGTAGTTCAGCCTGGCAGAACGCTGCTCTGATAAGGCAGAGGTCCACAGTTCAAA
TCTGTGCAGGCTCATtt
Downstream region at tRNA end position
ccgaagcata
Secondary structure (Cloverleaf model)
>W1910716619	Ile	GAT
                   T      ATtt ccgaagcata
                     G - C
                     A - T
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     G T G T C     A
      C G A        A      | | | | |     A
    C       C T T G       C A C A G     C
    T       | | | |                 T T
    G       G A A C
      G C A        G     AGGTC
                    C - G
                    T - A
                    G - C
                    C - G
                    T + G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK