The detailed information of tRNA gene sequence


Sequence ID>W1910716620
Genome IDMFWO01000014
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 7220
End posion on genome 7148
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
ctaggaaaaa
tRNA gene sequence
GCCCCGTTAGTTCAGAGGCCAAGAATGCGGCCCTTTCACGGCCGTGACCCGAGTTCGAAT
CTCGGACGGGGCGtcc
Downstream region at tRNA end position
taatcaatat
Secondary structure (Cloverleaf model)
>W1910716620	Glu	TTC
                   a      Gtcc taatcaatat
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     G G C T C     A
      A G A        A      | | | | |     G
    G       C T T G       C C G A G     C
    G       | | | +                 T T
    C       G A A T
      C A A        G     TGAC
                    C - G
                    G - C
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK