The detailed information of tRNA gene sequence


Sequence ID>W1910716624
Genome IDMFWO01000022
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 7764
End posion on genome 7837
Amino Acid Val
Anticodon GAC
Upstream region at tRNA start position
gcaacgaagT
tRNA gene sequence
GGCCTTGTAGTCTAATGGTAGAACATGTCCTTGACGTGGACAAAGCCCCAGTTCGATCCT
GGGCAGGGCCATCa
Downstream region at tRNA end position
ctccactaac
Secondary structure (Cloverleaf model)
>W1910716624	Val	GAC
                   T      ATCa ctccactaac
                     G - C
                     G - C
                     C - G
                     C - G
                     T + G
                     T - A
                     G - C          C T
                    T     G G G T C     A
        A A        A      | | | | |     G
      T     T C T G       C C C A G     C
      G     +   | |                 T T
      G     G A A C
        T A        A     AAGC
                    T - A
                    G - C
                    T - A
                    C - G
                    C - G
                  T       T
                  T       G
                    G A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK