The detailed information of tRNA gene sequence


Sequence ID>W1910716625
Genome IDMFWO01000027
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 15404
End posion on genome 15333
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
acaacgtgaa
tRNA gene sequence
GCCTCAATGGTCTAACGGCTATGACTCATCCCTGTCGCGGATGCGATCCGGGTTCGACTC
CCGGTTGGGGCGttg
Downstream region at tRNA end position
acttcttgtc
Secondary structure (Cloverleaf model)
>W1910716625	Asp	GTC
                   a      Gttg acttcttgtc
                     G - C
                     C - G
                     C - G
                     T + G
                     C - G
                     A - T
                     A - T          T C
                    T     G G C C C     A
      C A A        G      | | | | |     G
    G       T C T G       C C G G G     C
    G         | | |                 T T
    C       T G A C
      T A          T     CGAT
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  C       C
                  T       G
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK