The detailed information of tRNA gene sequence


Sequence ID>W1910716629
Genome IDMFWO01000030
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 3378
End posion on genome 3295
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
tattatagac
tRNA gene sequence
GCGGGTATGCCGGAGTGGTCAAACGGGCTGGATTTAGGCTCCAGTAGCTTAGTGCTTGCA
TAGGTTCGAATCCTATTACCCGCAttt
Downstream region at tRNA end position
tacaataaaa
Secondary structure (Cloverleaf model)
>W1910716629	Leu	TAG
                   c      Attt tacaataaaa
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     A - T          T A
                    T     T A T C C     A
      T G A        G      | | | | |     G
    G       G G C C       A T A G G     C
    G         | | |                 T T
    T       A C G G
      C A A        G     TAGCTTAGTGCTTGC
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  T       C
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK