The detailed information of tRNA gene sequence


Sequence ID>W1910716630
Genome IDMFWO01000032
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 12383
End posion on genome 12312
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
gtataaatac
tRNA gene sequence
GCCTGTGTAGCTCAGGGGCAGAGCACTTGCTTCGTAAGCAAGGGGTCGGGGGTTCAACTC
CCTCCACAGGCTttc
Downstream region at tRNA end position
gaatgaaatg
Secondary structure (Cloverleaf model)
>W1910716630	Thr	CGT
                   c      Tttc gaatgaaatg
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C
                     T - A
                     G - C          T C
                    T     C T C C C     A
        G A        A      | + | | |     A
      G     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        C A        A     GGGTC
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK