The detailed information of tRNA gene sequence


Sequence ID>W1910716632
Genome IDMFWO01000033
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 10457
End posion on genome 10527
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tttagagaaa
tRNA gene sequence
GCGCCAATAGTTTATCGGCAGAATTTTTGCTTCCCAAGCAAAAGGACCGGGTTCAATTCC
CGGTTGGCGCAtaa
Downstream region at tRNA end position
aaacccctcg
Secondary structure (Cloverleaf model)
>W1910716632	Gly	CCC
                   a      Ataa aaacccctcg
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     A - T
                     A - T          T T
                    T     G G C C C     A
        T A        A      | | | | |     A
      C     T T T G       C C G G G     C
      G     + | | +                 T T
      G     G A A T
        C A        T     AGGA
                    T - A
                    T - A
                    T - A
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK