The detailed information of tRNA gene sequence


Sequence ID>W1910716633
Genome IDMFWO01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_16_35_8 (MFWO)
Start position on genome 2579
End posion on genome 2509
Amino Acid Ala
Anticodon TGC
Upstream region at tRNA start position
ggttgtgcaa
tRNA gene sequence
GGGCTTGTAGTCTAGTGGTAGAACACCTCGTTTGCACCGAGGAGATCCGGGTTCGATTCC
CGGCAAGTCCAtaa
Downstream region at tRNA end position
gattttttct
Secondary structure (Cloverleaf model)
>W1910716633	Ala	TGC
                   a      Ataa gattttttct
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     T - A
                     G - C          T T
                    T     G G C C C     A
        G A        A      | | | | |     G
      T     T C T G       C C G G G     C
      G     +   | |                 T T
      G     G A A C
        T A        A     AGAT
                    C - G
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK